That Ponyo Meme But With Heisenberg Because It Fits Way Too Well 

That Ponyo Meme But With Heisenberg Because It Fits Way Too Well 

That ponyo meme but with Heisenberg because it fits way too well 

More Posts from Quinn-loves-liam and Others

3 years ago

time to get….nsfw…. *proceeds to commit multiple osha violations*

4 years ago
Overly Sarcastic Productions Reminding Me Of Stories I Had No Idea Connected To My New Favorite Greek
Overly Sarcastic Productions Reminding Me Of Stories I Had No Idea Connected To My New Favorite Greek
Overly Sarcastic Productions Reminding Me Of Stories I Had No Idea Connected To My New Favorite Greek

Overly Sarcastic Productions reminding me of stories I had no idea connected to my new favorite Greek god

This is referencing the Golden Touch story!

4 years ago

HELL YEAH WE DO YOU ROCK!!!!

can you draw your copy of the purple guy - or just the generic fandom purple guy with his hair down (if it's long) please :3? i love your art style so much!!

Can You Draw Your Copy Of The Purple Guy - Or Just The Generic Fandom Purple Guy With His Hair Down (if

Him with long hair, cause we need more Vincent with his long hair down ;)

4 years ago

I RE-RESPONDED in the COMMENTS OF the POST AND I MISTEPYED WORDS BECAUISE MY SOCIAL ANXIETY AND HOW STAR STUCK I WAS THEY ACTUALLY RELPLIED GOT THE BETTER OF ME-

AAAAAAAAAAAAAAAAAAAA the person i look up two actually saw what i sent an ask to them about and now im terrified i’ve made a fool of myself in spite of them seeming to enjoy what i said- i wanna talk to them and maybe be friends but idk how to be a normal humannn eeee

3 years ago

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

3 years ago
Only Day You Can Rb This
Only Day You Can Rb This

Only day you can rb this

1 year ago

today i overheard a girl say "no, f*ck that. i will be lovely to everyone. maybe some people will remember they have a heart."

1 year ago
💗EVAPORATE💗
💗EVAPORATE💗

💗EVAPORATE💗

3 years ago

once a girl reported me to an administrator at school bc i was breaking dresscode and she didnt like me. so i pushed her down the stairs. i just kept walking and i dont think she saw me and i never got caught. i know she got very seriously injured and they had to call an ambulance and she transferred schools bc she knew SOMEONE pushed her and she didnt feel safe. ive never regretted it. its been years since i graduated and im on mood stabilizers now, but sometimes when someone is testing my patience i calm myself down by thinking about how good it felt to snap once and how i cant do that again bc i would go to prison probably

image
image
  • kaviasposts
    kaviasposts liked this · 6 months ago
  • yaypinecones
    yaypinecones liked this · 6 months ago
  • as8bakwthesage
    as8bakwthesage liked this · 1 year ago
  • m4r1-12
    m4r1-12 liked this · 1 year ago
  • sadplanets
    sadplanets reblogged this · 1 year ago
  • noobiescrub
    noobiescrub liked this · 1 year ago
  • deviljinveto
    deviljinveto liked this · 1 year ago
  • negahoozi
    negahoozi liked this · 1 year ago
  • ladyvonheisenberg
    ladyvonheisenberg liked this · 1 year ago
  • lostdragonrider
    lostdragonrider liked this · 2 years ago
  • aceofnades
    aceofnades liked this · 2 years ago
  • mayynaves
    mayynaves liked this · 2 years ago
  • phoenixpinks
    phoenixpinks reblogged this · 2 years ago
  • jimmy-johns5382
    jimmy-johns5382 liked this · 2 years ago
  • cindeu
    cindeu liked this · 2 years ago
  • joydoesathing
    joydoesathing liked this · 2 years ago
  • well-that-happened
    well-that-happened liked this · 2 years ago
  • houseofashesif
    houseofashesif liked this · 2 years ago
  • pietrobr123
    pietrobr123 liked this · 2 years ago
  • psycho-doves
    psycho-doves liked this · 2 years ago
  • digitaldummy
    digitaldummy liked this · 2 years ago
  • k9tron
    k9tron liked this · 2 years ago
  • messytimemachine
    messytimemachine liked this · 2 years ago
  • ifreakinglovetheriddler
    ifreakinglovetheriddler liked this · 2 years ago
  • thesymbiotewolf
    thesymbiotewolf liked this · 2 years ago
  • hatsunemiku1579
    hatsunemiku1579 reblogged this · 2 years ago
  • sparkboundd
    sparkboundd reblogged this · 2 years ago
  • sparkboundd
    sparkboundd liked this · 2 years ago
  • x-v0rt3x-x
    x-v0rt3x-x liked this · 2 years ago
  • maikelfist
    maikelfist reblogged this · 2 years ago
  • lobamonster47
    lobamonster47 liked this · 2 years ago
  • spadesxion
    spadesxion liked this · 2 years ago
  • halewe
    halewe liked this · 2 years ago
  • spookyscarybittybones
    spookyscarybittybones liked this · 2 years ago
  • queenoftheidots
    queenoftheidots liked this · 2 years ago
  • veronica-edesk
    veronica-edesk reblogged this · 2 years ago
  • cabaken
    cabaken liked this · 2 years ago
  • hermitminded
    hermitminded liked this · 2 years ago
  • batplague
    batplague reblogged this · 2 years ago
  • ashyzzz
    ashyzzz liked this · 2 years ago
  • curiousbluecat
    curiousbluecat reblogged this · 2 years ago
  • curiousbluecat
    curiousbluecat liked this · 2 years ago
  • thegayblob
    thegayblob reblogged this · 2 years ago
  • korrolrezni
    korrolrezni reblogged this · 2 years ago
  • korrolrezni
    korrolrezni liked this · 2 years ago
  • risenfromtherath
    risenfromtherath liked this · 2 years ago
  • art-by-bearkun
    art-by-bearkun liked this · 2 years ago
quinn-loves-liam - [insert meme here]
[insert meme here]

21, any pronounds really but i prefer they/them or he/him. Proud posessive polyamorous pansexual person.

284 posts

Explore Tumblr Blog
Search Through Tumblr Tags