Quinn-loves-liam - [insert Meme Here]

quinn-loves-liam - [insert meme here]

More Posts from Quinn-loves-liam and Others

3 years ago

Omg omg can u make the snom soft bodies?? I wanna see em plop n jiggle

here they come! here they come!

Omg Omg Can U Make The Snom Soft Bodies?? I Wanna See Em Plop N Jiggle
3 years ago

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

3 years ago

god my friend’s nsfw gif of karl and an anon getting fucked got stolen by this rando https://twitter.com/B4byAlyx?s=09 please report it

3 years ago

p- pie- pirate

Doing An Art Trade With @xbobatea I Hope You Like It!!! ^^

doing an art trade with @xbobatea I hope you like it!!! ^^

3 years ago

people wanna talk about "don't self diagnose autism" meanwhile the autism test is damn near 3k dollars, a lot of people don't believe women can have autism, and (for black people) doctors don't believe them when they say they have literally anything. so.

3 years ago

i am so so sick of white gay ppl trying to make antiracism movements about them like if i see one more motherfucker on tiktok respond to a pocs video with the FUCKING “uwu but i have adhd and im gay / trans how can u say im not oppressed” like shut up this is not about u and just because u are queer does not negate the fact that you benefit from white privilege stay in your fucking lane and check urself 

3 years ago
I Made An Absolutely Random Meme XD Lkdsasdl

I made an absolutely random meme xD lkdsasdl

4 years ago

Others have hurt me, lied, and broke me down when there was no sense of self left from me catering to them as best i can. other got board of me when i gave my all or where hurt when i wanted time to be better. you built me up and gave me space to be myself and encouraged me rationally to do what’s best for me even if it hurt you in the prosses. You make your boundaries clear and keep me from feeling fear when we need to talk. i love you. thank you so much for everything you do for me and everything you will do even when you don’t have to. I hope i do as much good for you as you do for me beloved. <3 you’re my everything.


Tags
  • starlightseraph
    starlightseraph liked this · 3 weeks ago
  • fall-warning
    fall-warning liked this · 4 weeks ago
  • zkfae
    zkfae reblogged this · 4 weeks ago
  • wonder-grey
    wonder-grey liked this · 1 month ago
  • wcwit
    wcwit reblogged this · 1 month ago
  • zkfae
    zkfae liked this · 1 month ago
  • outoftouchnarwhal
    outoftouchnarwhal reblogged this · 1 month ago
  • rivermosscat
    rivermosscat liked this · 1 month ago
  • outoftouchnarwhal
    outoftouchnarwhal liked this · 1 month ago
  • intothewildgreenwhatever
    intothewildgreenwhatever reblogged this · 1 month ago
  • b4rkcore
    b4rkcore reblogged this · 1 month ago
  • thunder-the-ranger-wolf
    thunder-the-ranger-wolf reblogged this · 1 month ago
  • alixig
    alixig liked this · 1 month ago
  • walugus-grudenburg
    walugus-grudenburg liked this · 1 month ago
  • medicalmrowpractice
    medicalmrowpractice liked this · 1 month ago
  • theimprobablepossibilities
    theimprobablepossibilities liked this · 1 month ago
  • thewishfrog
    thewishfrog liked this · 1 month ago
  • namelessanon
    namelessanon liked this · 1 month ago
  • crime-soncloud
    crime-soncloud liked this · 1 month ago
  • kiqilinn
    kiqilinn liked this · 1 month ago
  • d0nut-gh0st
    d0nut-gh0st liked this · 1 month ago
  • gachadaddy
    gachadaddy liked this · 1 month ago
  • alisnotanalien
    alisnotanalien liked this · 1 month ago
  • aliothbuzzsawshark
    aliothbuzzsawshark liked this · 1 month ago
  • carro179
    carro179 reblogged this · 1 month ago
  • carro179
    carro179 liked this · 1 month ago
  • food-lover9000
    food-lover9000 reblogged this · 1 month ago
  • food-lover9000
    food-lover9000 liked this · 1 month ago
  • rose022
    rose022 reblogged this · 1 month ago
  • bigbromelvin
    bigbromelvin liked this · 1 month ago
  • for-tomorrow-may-rain-so
    for-tomorrow-may-rain-so reblogged this · 1 month ago
  • twilighthiro
    twilighthiro liked this · 1 month ago
  • upsilambic
    upsilambic reblogged this · 1 month ago
  • yaboydeidara
    yaboydeidara liked this · 1 month ago
  • 420blazblade
    420blazblade reblogged this · 1 month ago
  • kodocookies
    kodocookies reblogged this · 1 month ago
  • lotsofrandomthings
    lotsofrandomthings reblogged this · 1 month ago
  • lotsofrandomthings
    lotsofrandomthings liked this · 1 month ago
  • looksontempests
    looksontempests reblogged this · 2 months ago
  • caiscagames
    caiscagames reblogged this · 2 months ago
  • vampire-cutie
    vampire-cutie reblogged this · 2 months ago
  • rfoxlord
    rfoxlord reblogged this · 2 months ago
  • midnightsnapdragon
    midnightsnapdragon reblogged this · 2 months ago
  • penultra
    penultra liked this · 2 months ago
  • rosspadalecki
    rosspadalecki reblogged this · 2 months ago
  • ideasandinformation
    ideasandinformation reblogged this · 2 months ago
  • gayonwords
    gayonwords liked this · 2 months ago
  • cosmicsoiree
    cosmicsoiree reblogged this · 2 months ago
quinn-loves-liam - [insert meme here]
[insert meme here]

21, any pronounds really but i prefer they/them or he/him. Proud posessive polyamorous pansexual person.

284 posts

Explore Tumblr Blog
Search Through Tumblr Tags